😎Hello, my dear friend, thanks for visiting😎
🤡my programming playground🤡
----------------------

      
        import requests

        # input of sequencing result
        flt3_seq = 'CAATTTAGGTATGAAA......AAATGCTGAAAGGTACAGTA'       # Your FLT3-ITD sequence from NGS result 

        url = 'https://flt3-itd-nomenclature.ue.r.appspot.com/nucleotideSequence/'+flt3_seq
        r = requests.get(url)
        nomenclature = r.json()
        
        # the nomenclature you get is a dictionary:
        {'aaDupIns': 'NGMCQMFLQHFPRENLEFGK',                # full ins/dup aa sequence
        'aaLength': 20,                                     # itd aa length
        'additionalInfo': [                                 # additional information (in a list)
        "There is no insertion or variant(s) identified at the 3'-end of the ITD.", 
        'This FLT3-ITD involves the intronic region; ......'
        ], 
        'hgvsc': 'c.1816_1837+38dup',                       # nomenclature at cDNA level
        'hgvsg': 'chr13:g.28608181_28608240dup',            # nomenclature at chromosome level
        'hgvsp': 'p.K614_V615ins20[NGMCQMFLQH;605_614]',    # nomenclature at protein (aa) level
        'nucleotideDupIns': 'CCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTC',       # full ins/dup nucleotide sequence
        'nucleotideLength': 60,                             # flt3-itd length (nucleotide)
        'nucleotideSequence': 'CAATTTAGGTATGAAA......AAATGCTGAAAGGTACAGTA',       # the original sequence submitted
        'status': 'OK'}                                     # result status: OK or Error message